Mercury

From BioDesign for the Real-World
Jump to: navigation, search
Mercury

About Mercury

Mercury Cycle source teachers.yale.edu

Mercury is the a metal that exists as a liquid at room temperature, readily forms amalgams with other metals except iron.

Because of its toxicity, many mercury containing materials and processes are being replaced by mercury-free ones.
Mercury around us:

  • electronics components, lamps (mercury lamps, fluorescent lamps)
  • mercury thermometers, manometers - as in "mmHg"
  • dental fillings

In industrial processes:

  • industrial chemistry to make organic and inorganic mercury compounds, for chlorine and caustic soda production (now replaced by other methods), and as catalysts.


It is released in the environment in several ways, as can be seen in the diagram of the mercury cycle on the right.

Toxicity to humans, other than direct absorption through skin or mucus membrane contact (including inhalation) is through the accumulation of organic mercury up the food chain, also illustrated in the mercury cycle on the right.
The Organomercury Pathway Map.

The US FDA limit for Hg limit for consumption is 1.0ppm.

Methyl Mercury

Pubchem page on [1]
Cameo Chemical Page [2]

Why Mercury

Because mercury can bioaccumulate in the food chain, it can have visible detrimental impact on human health. The toxic and tragic effects of industrial waste water methyl mercury poisoning Minamata Disease became evident in Minamata in 1956.
In Switzerland, Hg contamination in the Valais Swiss soil sampling data mentioned in an article 02.2015.

Methods for testing for Mercury

Water Sampling


List of Materials Necessary

  • Protective clothing (bodysuit, gloves)

Sample Preparation

  • Filter
  • Recipient vials - teflon > glass or
  • Sample stabilization (acid vs freezing)

Soil Sampling

Analysis

Total Mercury

Methyl Mercury

The Biology behind the Bioreporter

The mercury genes in bacteria are summarized nicely in this blog on bioremediation.

Documentation

Bioreporter

merR-egfp
From the Laboratory of Jan van der Meer, UNIL (Lausanne, Switzerland), constructed at the Winter School 2016
The mercury bioreporter merR-egfp was constructed in one step as a transcriptional gfp fusion where the 560 bp DNA fragment (containing merR with the inducible promoter) from DNA2.0 synthesized plasmid pJ201-merR (in strain E. coli DH5a 4757, Km) cut with BamHI/ EcoRI was inserted into the pPROBE-egfp tagless plasmid, (in strain E. coli DH5a 1421, Km), cut with same enzymes.

  • pJ201-merR (containing merR, 4757, Km)
  • pProbe-gfp-tagless (strain 1421, Km)

Host: E. coli DH5a
Antibiotic Resistance: Km

References

Mer operon from Soon-Jung Park et al. J. Bacteriology 1992 p.2160-2171


PCR Primers for Insert Confirmation

Primer # Primer Name Sequence 5' > 3' Annealing Temp oC
140301 merR-fwd AAGGCGGCCGGGGTCAACGT 60
140302 merR-rev AGGCGCACACGAGTTCAGACAGCA 61
090209 pPROBE-fwd TGCCAGGAATTGGGGATCGGA 56
060517 pPROBE egfp-rev TGTGCCCATTAACATCACCATCTAAT 55

Protocol

References

Regulation